View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_high_17 (Length: 346)
Name: NF1310_high_17
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 191 - 334
Target Start/End: Original strand, 41783573 - 41783716
Alignment:
| Q |
191 |
tggtaacttttggaatcctattggagtgtttgcactattgaagtgaaaaggaggtgagttgcttaaaggtaatgcggtataataaggcctactttagcac |
290 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41783573 |
tggtaacttttggaatccgattggagtgtttgcactattgaagtgaaaaggaggtgagttgcttaaaggtaatgcggtataataaggcctactttagcac |
41783672 |
T |
 |
| Q |
291 |
accccaaggtggactacaccatcggtgatgttcttgctaatatt |
334 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
41783673 |
accccaaggcggactacaccatcagtgatgttcttgctaatatt |
41783716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 30 - 148
Target Start/End: Original strand, 41783412 - 41783530
Alignment:
| Q |
30 |
aatgaagtcgctagaatgcttataggagttcttaaactgtaatcagtttaatacttgaaaggtgtgacttaactatcacatgtaaggatggttgcttgta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41783412 |
aatgaagtcgctagaatgcttataggagttcttaaactgtaatcagtttaatacatgaaaggtgtgacttaactatcacatgtaaggatggttgcttgta |
41783511 |
T |
 |
| Q |
130 |
gaataagcaaccaatccat |
148 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41783512 |
gaataagcaaccaatccat |
41783530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University