View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_high_28 (Length: 277)
Name: NF1310_high_28
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 55 - 242
Target Start/End: Original strand, 20027845 - 20028032
Alignment:
| Q |
55 |
accattcagctcatatggctccaatcataacccctgccgccgccattgtagccgggaaaatcaacattaagctgcgcgttcgtgtgatacacctcaggac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20027845 |
accattcagctcatatggctccaatcataacccctgccgccgccattgtagctgggaaaatcaacattaagctgcgcgttcgtgtgatacacctcaggac |
20027944 |
T |
 |
| Q |
155 |
aattcctgaatttaacaagcctaatgaggataattctatccacgtgatgttgctggacgataaggttacaattttgtgttatattatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20027945 |
aattcctgaatttaacaagcctaatgaggataattctatccacgtgatgttgctggacgataaggttacaattttgtgttatattatt |
20028032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University