View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_high_29 (Length: 274)
Name: NF1310_high_29
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_high_29 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 174 - 274
Target Start/End: Original strand, 336052 - 336152
Alignment:
| Q |
174 |
atgttatgagattggctctaggctatagttgcttttgtgaggtaaaaatttggtagcttttttcttctaacgacacaacaaacctactgttttgttttca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336052 |
atgttatgagattggctctaggctatagtttcttttgtgaggtaaaaatttggtaggttttttcttctaacgacacaacaaacctactgttttgttttca |
336151 |
T |
 |
| Q |
274 |
t |
274 |
Q |
| |
|
| |
|
|
| T |
336152 |
t |
336152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 53 - 119
Target Start/End: Original strand, 335931 - 335997
Alignment:
| Q |
53 |
aatagtagatcttattattcctgatcgtgctattaatcaaacttactaaaactttcttgtgttgcta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
335931 |
aatagtagatcttattattcctgatcgtgctattaatcaaacctacaaaaactttcttgtgttgcta |
335997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University