View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_16 (Length: 355)
Name: NF1310_low_16
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 45340817 - 45340557
Alignment:
| Q |
1 |
ctctcagtttcatctgtagtatgcgtttgaagagtgnnnnnnngtagtgattcttttggacttgtgtatatacacatcacatattataggtatgatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45340817 |
ctctcagtttcatctgtagtatgcgtttgaagagtgttttttggtagtgattcttttggacttgtgtatatacacatcacatattataggtatgatcact |
45340718 |
T |
 |
| Q |
101 |
ttcatgtgacacgtgatgaatggatctatagatgaaaggtgacgatgagaacatgaatattgtgcttattacaa-nnnnnnngatgatagattggattag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45340717 |
ttcatgtgacacgtgatgaatggatctatagatgaaaggtgacgatgagaacatgaatattgtgcttattacaattttttttgatgatagattggattag |
45340618 |
T |
 |
| Q |
200 |
attggaaacatgtggggactgaggaggagaggatataaagttccaggcccaacaatgtttt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45340617 |
attggaaacatgtggggactgaggaggagaggatataaagttccaggcccaacaatgtttt |
45340557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University