View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_23 (Length: 318)
Name: NF1310_low_23
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 11 - 289
Target Start/End: Original strand, 411508 - 411786
Alignment:
| Q |
11 |
cagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411508 |
cagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaa |
411607 |
T |
 |
| Q |
111 |
tctgattttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagctttatgagcgttgga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
411608 |
tctgattttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagctttatgagtgttgga |
411707 |
T |
 |
| Q |
211 |
agaacatcgcgtaggaagaaagcgcttatggctattggcgtcgatgaagagccaaataaggaagctcttgagaatattg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411708 |
agaacatcgcgtaggaagaaagcgcttatggctattggcgtcgatgaagagccaaataaggaagctcttgagaatattg |
411786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University