View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_25 (Length: 314)
Name: NF1310_low_25
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 62 - 284
Target Start/End: Complemental strand, 10682558 - 10682336
Alignment:
| Q |
62 |
agcataggtttaagatgatgttttctgtacctatatattctttttgttgcggttcaattgcagaatttgatgtgtattgtgtgtttgattagaaactctg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10682558 |
agcataggtttaagatgatgttttctgtacctatatattctttttgttgcggttcaattgcagaatttgatgtgtattgtgtgtttgattagaaactctg |
10682459 |
T |
 |
| Q |
162 |
ctgctatgctctgaaaaagcatattgtttcttgaattatatgatttaatgttgaatgcaaaatgttttgtatttgtttataaagttgtctcagaggagta |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10682458 |
ctgctatgctctgaaaaagcatattgtttcttgaattatatgatttaatgttgaatgcaaaatgttttgtatttgtttataaagttgtctcaggggagta |
10682359 |
T |
 |
| Q |
262 |
ttatacaccgtagactgtacgta |
284 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10682358 |
ttatacaccgtagactgtacgta |
10682336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University