View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_29 (Length: 303)
Name: NF1310_low_29
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 102 - 222
Target Start/End: Complemental strand, 53014029 - 53013910
Alignment:
| Q |
102 |
aattagaacggggaggatcagctagaggaatatggttaaaaatctcgtctaaattataaacttattgaattagtgtttaaagtgaaaggtttttacaatg |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53014029 |
aattagaacggggaggatcagccagaggaatatggttaaaaatctcgtctaaattataa-cttattgaattagtgtttaaagtgaaaggtttttacaatg |
53013931 |
T |
 |
| Q |
202 |
cggtgaatttcagtatttgat |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53013930 |
cggtgaatttcagtatttgat |
53013910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University