View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_38 (Length: 262)
Name: NF1310_low_38
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_38 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 29 - 262
Target Start/End: Original strand, 21493017 - 21493250
Alignment:
| Q |
29 |
aaccttcccttctaattttggatgaacctacatccggtttggacagctcatcttctcagttacttcttagagcacttagacgcgaggctcttgaaggagt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21493017 |
aaccttcccttctaattttggatgaacctacatccggtttggacagttcatcttctcagttacttcttagagcacttagacgcgaggctcttgaaggagt |
21493116 |
T |
|
| Q |
129 |
aaacatatgcatggtccttcaccaaccgaggtaactttcaatagaaaatgctaacaagtactctgtgaacatcaagaatgataattgttatatcgacaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21493117 |
aaacatatgcatggtccttcaccaaccgaggtaactttcagtagaaaatgctaacaagtactctgtggacatcaagaatgataattgttatatcgacaca |
21493216 |
T |
|
| Q |
229 |
ctcactaaccctctttcaacaataatctctatta |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21493217 |
ctcactaaccctctttcaacaataatctctatta |
21493250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 49 - 162
Target Start/End: Complemental strand, 41042253 - 41042140
Alignment:
| Q |
49 |
gatgaacctacatccggtttggacagctcatcttctcagttacttcttagagcacttagacgcgaggctcttgaaggagtaaacatatgcatggtccttc |
148 |
Q |
| |
|
||||| |||||| | |||||||||||| |||||||| |||||||||| ||| ||| | || || ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41042253 |
gatgagcctacaactggtttggacagcgcatcttctagtttacttcttaaagcgcttcgtcgtgaagctcttgaaggtgtaaacatatgcatggtacttc |
41042154 |
T |
|
| Q |
149 |
accaaccgaggtaa |
162 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
41042153 |
accaaccaaggtaa |
41042140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University