View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_43 (Length: 251)
Name: NF1310_low_43
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 28 - 247
Target Start/End: Original strand, 26925760 - 26925979
Alignment:
| Q |
28 |
catcattgtcttcaaagaaaagaagcaccaagcacggtgatgatggtgatcatgagaatgatggtagtggggatggtgattgtttttactcatcaacatc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26925760 |
catcattgtcttcaaagaaaagaagcaccaagcacggtgatgatggtgatcatgagaatgatggtagtggggatggtgattgtttttactcatcaacatc |
26925859 |
T |
 |
| Q |
128 |
acccttgcaatataaggagaagaaatcctcaagacgggatcgcaagaaaggtcgtgttggaatatggaggcctcatttagcaagtatttctgaagactag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26925860 |
acccttgcaatataaggagaagaaatcctcaagacgggatcgcaagaaaggtcgtgttggaatatggaggcctcatttagcaagtatttctgaagattaa |
26925959 |
T |
 |
| Q |
228 |
gtagttttcagaattgtcag |
247 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
26925960 |
atggttttcagaattgtcag |
26925979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University