View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1310_low_46 (Length: 210)
Name: NF1310_low_46
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1310_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 19858908 - 19859037
Alignment:
| Q |
1 |
acagaaaagaagtgtaagttcattaaaatgtagacctcatgctgagattccggatcatgcttcttgtgacactgttacttttggaaaatcttgcgatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19858908 |
acagaaaagaagtgtaagttcattaaaatgtagaccacatgctgagattccggatcatgctgcttgtgacactgttacttttggaaaatcttgtgatgat |
19859007 |
T |
 |
| Q |
101 |
cgttggaaaaactacaagggtggtaatatt |
130 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
19859008 |
ggttggaaaaactacaacggtggtaatatt |
19859037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 22688937 - 22688853
Alignment:
| Q |
16 |
aagttcattaaaatgtagacctcatgctgagattccggatcatgcttcttgtgacactgttacttttggaaaatcttgcgatgat |
100 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||||||| | | || | ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
22688937 |
aagttcatcaaaatatagacctcatgccgagattcctaaacttgttggttgtggcactgttacttttggaaaatctagcgatgat |
22688853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University