View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13110_high_4 (Length: 262)
Name: NF13110_high_4
Description: NF13110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13110_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 246
Target Start/End: Original strand, 42473073 - 42473311
Alignment:
| Q |
8 |
tgaaatgaagcacacctagaaagatatgggccattttccagcacaactttggcaaattcatcatcatattttgctgcaacctttgccattgacagaaaag |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473073 |
tgaaatgaagcacaactagaaagatatgggccattttccagcacaactttggcaaattcatcatcatattttgctgcaacctttgccattgacagaaaag |
42473172 |
T |
 |
| Q |
108 |
catcttggtgtcttgcttctctagtttcaccatcacgactaaaatcaacatcttgaagtgttaaattacgaacaatgtcaatcgaagtcttgagacatac |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473173 |
catcttggtgtcttgcttcgctagtttcaccatcacgactaaaatcaacatcttgaagtgttaaattacgaacaatgtcaatcgaagtcttgagacatac |
42473272 |
T |
 |
| Q |
208 |
tcgattcttcttaatttgatctgatttttgcacatcaat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473273 |
tcgattcttcttaatttgatctgatttttgcacatcaat |
42473311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University