View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13110_low_7 (Length: 237)
Name: NF13110_low_7
Description: NF13110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13110_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 38 - 222
Target Start/End: Complemental strand, 33488739 - 33488555
Alignment:
| Q |
38 |
agatttgacagaggccacctgaatgaaatatcatcaaagtggaaccttaaaatagtgatattatatagaatgaaagtgatcttatttttagtttaatgtg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33488739 |
agatttgacagaggccacctgaatgaaatatcatcaaagtggaaccttaaaatagtgatattatatagaatgaaagagatcttatttttagtttaatgtg |
33488640 |
T |
 |
| Q |
138 |
ttatttttcaagaggttaggtgtatgaaagggaaaaccactatagttttatgaatcttagaaaatggttgaagaggagttggaat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33488639 |
ttatttttcaagaggttaggtgtatgaaagggaaacccactatagttttatgaatcttagaaaattgttgaagaggagttggaat |
33488555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University