View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13111_low_4 (Length: 266)
Name: NF13111_low_4
Description: NF13111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13111_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 31860709 - 31860454
Alignment:
| Q |
1 |
ttgatgtactgggggttggtgagtgttttagagtaatctatgtgttgtaattttgtacataaagttgtattctttagctgtcatcttgtcagtagacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860709 |
ttgatgtactgggggttggtgagtgttttagagtaatctatgtgttgtaattttgtacataaagttgtattctttagctgtcatcttgtcagtagacaac |
31860610 |
T |
 |
| Q |
101 |
ggtcgtggttttttcacttgttttagagtttctatattgtgtttatgtgttgtgattgcattcctttattattattttttataaaggttttttccaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860609 |
ggtcgtggttttttcacttgttttagagtttctatattgtgtttatgtgttgtgattgcattcctttattattattttttataaaggttttttccaaaag |
31860510 |
T |
 |
| Q |
201 |
ttggtatcatatcttttggttcaatccaaggataagaattcttagtatgctctgtg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860509 |
ttggtatcatatcttttggttcaatccaaggataagaattcttagtatgctctgtg |
31860454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University