View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13112_high_11 (Length: 346)
Name: NF13112_high_11
Description: NF13112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13112_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 92 - 346
Target Start/End: Original strand, 46090967 - 46091221
Alignment:
| Q |
92 |
gagagcaattaatgccagtaatctagctagtgaagtttttctaatcaggttcatcttatttaatattaaaatttatcaatttggaaataatatttcaaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46090967 |
gagagcaattaatgccagtaatctagctagtgaagtttttctaatcaggttcatcttatttaatattaaaatttatcaatttggaaataatatttcaaaa |
46091066 |
T |
 |
| Q |
192 |
acnnnnnnncctcttttgaattggcgcgcaaccgcaaagattaatatcttgtatcgggtaggactgcaataagtgacaaaattctcactcaagagattta |
291 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46091067 |
actttttttcctcttttgaattggcgcgcaaccgcaaagattaatatcttatgtcgggtaggactgcaataagtgacaaaattctcactcaagagattta |
46091166 |
T |
 |
| Q |
292 |
acactattgcatttcgagaataatatttgaactcagaacctatggttacgatgga |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46091167 |
acactattgtatttcgagaataatatttgaactcagaacctatggttatgatgga |
46091221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 305
Target Start/End: Original strand, 34671288 - 34671328
Alignment:
| Q |
265 |
tgacaaaattctcactcaagagatttaacactattgcattt |
305 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| |||| |
|
|
| T |
34671288 |
tgacaaaactctctctcaagagatttaacactattgtattt |
34671328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University