View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13112_high_15 (Length: 253)
Name: NF13112_high_15
Description: NF13112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13112_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 6 - 123
Target Start/End: Complemental strand, 30687320 - 30687203
Alignment:
| Q |
6 |
agtagcataggaaggagatgataaagataagatatctgtcactggtgataacgtagacacagtttgcttagccaacatgctaaagaagaagttcaactgt |
105 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30687320 |
agtatcattggaaggagatgataaagataagatatctgtcactggtgataatgtagacacagtttgcttagccaacatgctaaagaagaagttcaactgt |
30687221 |
T |
|
| Q |
106 |
gtcaccattctaagcgtg |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30687220 |
gtcaccattctaagcgtg |
30687203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 30687126 - 30687089
Alignment:
| Q |
200 |
tgatggaagcatgtcgtactgttttgtttggttcttgc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30687126 |
tgatggaagcatgtcgtactgttttgtttggttcttgc |
30687089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 118
Target Start/End: Original strand, 30682843 - 30682946
Alignment:
| Q |
15 |
ggaaggagatgataaagataagatatctgtcactggtgataacgtagacacagtttgcttagccaacatgctaaagaagaagttcaactgtgtcaccatt |
114 |
Q |
| |
|
||||||||||||||| ||| ||| ||| || |||||||| || |||| |||||||||||| ||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
30682843 |
ggaaggagatgataaggatcgtgtatgtgtgaccggtgataatgtggacatagtttgcttagcaaaccagctgaagaagaagttcaacaatgtcaccatt |
30682942 |
T |
|
| Q |
115 |
ctaa |
118 |
Q |
| |
|
|||| |
|
|
| T |
30682943 |
ctaa |
30682946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University