View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13112_high_5 (Length: 445)
Name: NF13112_high_5
Description: NF13112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13112_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 9 - 428
Target Start/End: Complemental strand, 34722855 - 34722436
Alignment:
| Q |
9 |
agcagagacagaaaccaacggcgtgccagcagaggaagccgcggctgaggatgatcccgggcccagaccgacgaagccgagggaataggaaagtacacca |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34722855 |
agcagatacagaaaccaacggcgtgccagcagaggaagccgcggctgaggatgatcccgggcccagacctacgaagccgagggaataggaaagtacacca |
34722756 |
T |
|
| Q |
109 |
ccaacagcccataatccgaaaccgattgctcctgagattaaccctagactaccggaaattacggagacgggtaatttgataagcttccaggctaatccgg |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34722755 |
ccagcagcccataatccgaaaccgattgctcctgagattaaccctagactaccggaaattacggagacgggtaatttgataagcttccaggctaatccgg |
34722656 |
T |
|
| Q |
209 |
gtggtggtggagggagtggcggttctgattgggatgatgattgtgattgtgatagaagatgagtgttttgatcggcgttgtcgttatcgccgccgtgagg |
308 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34722655 |
gtggtggtggagggagtggtggttctgattgggatgatgattgtgattgtgatagaagatgagtgttttgatcggcgttgtcgttatcgccgccgtgagg |
34722556 |
T |
|
| Q |
309 |
agtgtcggttgtggtgaaagatgagatggcgagttcgaggtcccaattatgagcggcgaggatctcggtacagaggtcgggatcttgtaaaccggtgatt |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34722555 |
agtgtcggttgtggtgaaagatgagatggcgagttcgaggtcccaattatgagcggcgaggatctcgttacagaggtcgggatcttgtaaaccggtgatt |
34722456 |
T |
|
| Q |
409 |
gcttgaaagtatgcgagttt |
428 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34722455 |
gcttgaaagtatgcgagttt |
34722436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University