View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13112_low_18 (Length: 252)
Name: NF13112_low_18
Description: NF13112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13112_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 245
Target Start/End: Original strand, 14134922 - 14135164
Alignment:
| Q |
3 |
cttgagttgtcaggtttccttcatttttagcagatcaaacacaccataaaccttccttgcacgccttagtttgagttataaatttcggaaaaaatggagc |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14134922 |
cttgaattgtcaggtttccttcatttttagcagatcaaacacaccataaaccttccttgcacgccttagtttgagttataaatttcggaaaaaatggagc |
14135021 |
T |
|
| Q |
103 |
annnnnnncacgtgttttaccctttttgggttatataattcaaaatcagtaaaacgtgagagactggtagggtggaaaaagaaacagtcaatatgttttg |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135022 |
atttttttcacgtgttttaccctttttgggttatataattcaaaatcagtaaaacgtgagagactggtagggtggaaaaagaaacagtcaatatgttttg |
14135121 |
T |
|
| Q |
203 |
atagcagttagattcaatagtcatgactgctggacctttgctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135122 |
atagcagttagattcaatagtcatgactgctggacctttgctt |
14135164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 6014932 - 6014960
Alignment:
| Q |
25 |
atttttagcagatcaaacacaccataaac |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6014932 |
atttttagcagatcaaacacaccataaac |
6014960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 3194848 - 3194816
Alignment:
| Q |
19 |
tccttcatttttagcagatcaaacacaccataa |
51 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
3194848 |
tccttcatttttagcagatcaagcacaccataa |
3194816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University