View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13113_high_9 (Length: 228)
Name: NF13113_high_9
Description: NF13113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13113_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 26030605 - 26030807
Alignment:
| Q |
13 |
gttcactggccatttctattgaaagatggggcaagcaggcctcctaaagcaggagaagtgtcggagttcgacatggaaggagtttggagagaaatggaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26030605 |
gttcactggccatttctattgaaagatggggcaagcaggcctcctaaagcaggagaagtgtcggagttcgacatggaaggagtttggagagaaatggaga |
26030704 |
T |
 |
| Q |
113 |
agcttgtcaaggaaaatcttgttagagacattggaatatgcaacttcactcttactaaactggataagctagtcaatattgctcaagttatgccttgtgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26030705 |
agcttgtcaaggaaaatcttgttagagacattggaatatgcaacttcactcttactaaactggataagctagtcaatattgctcaagttatgccttctgt |
26030804 |
T |
 |
| Q |
213 |
atg |
215 |
Q |
| |
|
||| |
|
|
| T |
26030805 |
atg |
26030807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University