View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13113_low_10 (Length: 217)
Name: NF13113_low_10
Description: NF13113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13113_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 51 - 201
Target Start/End: Complemental strand, 37649977 - 37649827
Alignment:
| Q |
51 |
catttagatttttattgaaattacggtaaccttaatatttggtattatcttgggatactgataattgtttttgtgttgttgatgataggtttgaacctta |
150 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37649977 |
catttagatttttattgaaattaccgtaaccttaatatttggtattatcttgggatactgataattgtttttgtgttgttgatgataggtttgaacctta |
37649878 |
T |
 |
| Q |
151 |
cttgcagaatgcctgcaaaaggtttgttatggagcttaagccgacgttcat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37649877 |
cttgcagaatgcctgcaaaaggtttgttatggagcttaagccgacgttcat |
37649827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University