View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13113_low_11 (Length: 206)
Name: NF13113_low_11
Description: NF13113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13113_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 28730069 - 28730249
Alignment:
| Q |
1 |
ttgtaagaaaccatgaattgatacatcatacacaagataatctctcaagaaaatctgtaaagactaaatccacaaattgttttattaacgaactagttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28730069 |
ttgtaagaaaccatgaattgatacatcatacacaagataatctc--aagaaaatctgtaaagactaaatccaca-------ttattaacgaactagttaa |
28730159 |
T |
 |
| Q |
101 |
gcaacatagagtatatatggataatagtgtgaactaactacaaattcagagttacaattcatgagacaaagaagtgcagcacaaactaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
28730160 |
gcaacatagagtatatatggataatagtgtgaattaactacaaattcagagtttcacttcatgagacaaagaagtgcagcacaaactaaa |
28730249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 45 - 190
Target Start/End: Original strand, 38120529 - 38120672
Alignment:
| Q |
45 |
tcaagaaaatctgtaaagactaaatccacaaattgttttattaacgaactagttaagcaacatagagtatatatggataatagtgtgaactaactacaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||| ||| | ||||||||||||||| |||||||||| |
|
|
| T |
38120529 |
tcaagaaaatctgtaaagactaaatccacaaattgttttattgaagaactatttaagcaacatagtgtagtt--ggataatagtgtgaattaactacaaa |
38120626 |
T |
 |
| Q |
145 |
ttcagagttacaattcatgagacaaagaagtgcagcacaaactaaa |
190 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
38120627 |
ttcaaagtttcacttcatgagacaaagaagtgcagcacaaactaaa |
38120672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University