View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13113_low_3 (Length: 278)
Name: NF13113_low_3
Description: NF13113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13113_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 264
Target Start/End: Original strand, 8055082 - 8055310
Alignment:
| Q |
30 |
tcaatccgttaaacaaaactcatccattccatatgtaattagttgtagagacatatgtaattgtgacacgtatataaatcatagacactagaacctatg- |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8055082 |
tcaatccgttaaataaaactcatccattccatatgtaattagtggtagagacatatgtaattgtgacacgtatataaatcatagacactagaacctatgt |
8055181 |
T |
 |
| Q |
129 |
ttttattccacaataatccagaaataacacttgtaagttgtaacaatagatagatctttctggaacatttggaattttggacatcactctcgaactttct |
228 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8055182 |
ttttattccacaataatctagaaataacac-------ttgtaacaatagatagatctttctggaacatttggaattttggacatcactctcgaactttct |
8055274 |
T |
 |
| Q |
229 |
ctttattccctcattttcattttctatcatattatt |
264 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||| |
|
|
| T |
8055275 |
ctgtactccctcattttcattttctatcatattatt |
8055310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University