View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_high_24 (Length: 332)
Name: NF13114_high_24
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 21482960 - 21483265
Alignment:
| Q |
17 |
aacaataatatacagcttaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggtcc |
116 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482960 |
aacaataatataaagctgaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggtcc |
21483059 |
T |
|
| Q |
117 |
actggaggctgcgtcggctcagccggaacaacaggtgccaaggaagctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483060 |
actggaggctgcgtcggctcagccggaacaacaggtgccaaggaggctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgcat |
21483159 |
T |
|
| Q |
217 |
gagaaccaccagcagcaacattggtgcaattatcaccactacctaatctcgcaagtggatcagaaccttgaatattctgatgatggttattattatgatg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21483160 |
gagaaccaccagcagcaacattggtgcaactatcaccactacctaatctcgcaagtggatcagaaccttgaatattctgatgatggttaatattatgatg |
21483259 |
T |
|
| Q |
317 |
cctatg |
322 |
Q |
| |
|
|||||| |
|
|
| T |
21483260 |
cctatg |
21483265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University