View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_high_31 (Length: 276)
Name: NF13114_high_31
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 9535905 - 9535663
Alignment:
| Q |
18 |
attataagtctcatttctcttcggtttcttcatcctcttctggaggtggcaactcgttcagatcaaagtcccgtctccgccgttcttcattctcagccgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9535905 |
attataagtctcatttctcttcggtttcttcatcctcttctggaggtggcaactcgttcagatcaaagtcccgtctccgccgttcttcattctcagccgg |
9535806 |
T |
|
| Q |
118 |
tgcaggtgctggttcaggtgcaggtgcaggtgctgcttggatttccttagtgatatgaccactaccaccagcagaggaccctgcggttgattcaatcgat |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9535805 |
tgcaggtgctggttcaggtgcag------gtgctgcttggatttccttagtgatatgaccactaccaccagcagaggaccctgcggttgattcgatcgat |
9535712 |
T |
|
| Q |
218 |
ctattcagatcgaacacaagctcgcgagctaatgagctcaccccttcat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9535711 |
ctattcagatcgaacacaagctcgcgagctaatgagctcaccccttcat |
9535663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University