View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_high_36 (Length: 250)
Name: NF13114_high_36
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_high_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 45284207 - 45284446
Alignment:
| Q |
11 |
taatactaattggactatatacatagatagatatctaattaattcatgatttttatgtcattattgttacacttttatttgtatgccagcgtgactatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45284207 |
taatactaattggactatatacatagatagatatctaattaattcatgatttttatgtcattattgtcacacttttatttgtatgccagcgtgactatga |
45284306 |
T |
 |
| Q |
111 |
aaaagagattgaggatttgacaacggaattggccagctacaaggtgcaattagaagcaaagcatgttgcacacatcaaagcacttcttaagccggaacaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45284307 |
aaaagagattgaggatttgacaacggaattggccagctacaaggtgcaattagaagcaaagcatgttgcacacatcaaagcacttcttaagccagaacaa |
45284406 |
T |
 |
| Q |
211 |
aaccaaaagatgattcaggaattgtctaccttgttgaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45284407 |
aaccaaaagatgattcaggaattgtctaccttgttgaaaa |
45284446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University