View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_low_36 (Length: 271)
Name: NF13114_low_36
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 6283861 - 6284115
Alignment:
| Q |
1 |
gtttttccaataacacctccattgattatagatagaggaagggggtactatagttccagaaacacctggaggaaatgtggagggagagtatgtaggaaat |
100 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6283861 |
gtttttccaataacaccgccattaattatagatagaggaagggggtacgatagttctggaaacacctggaggaaatgtggagggagagtaggtaggaaat |
6283960 |
T |
|
| Q |
101 |
agttggatgcggtagggatttttcgttgacaaaggaatgacaaaatttattttaatatagaggatgaaacaatacttaagaagtcggtagaacatgaaaa |
200 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
6283961 |
agttggatgcagtagggatttttcgcttacaaaggaatgacaaaatttattttaatatagaggatgaaacaatacttaagaagtcggtagaacttgaaga |
6284060 |
T |
|
| Q |
201 |
agttgatgagttgaataaaggaagaagggagaaagcaagcagtggtaaataattg |
255 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
6284061 |
agttgatgagttgaataaaggaagaaaggagaaagcaagcagtggtcaatgattg |
6284115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 6305577 - 6305628
Alignment:
| Q |
187 |
gtagaacatgaaaaagttgatgagttgaataaaggaagaagggagaaagcaa |
238 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
6305577 |
gtagaacatgaagaagcagatgtgttgaataaaggaagaagggagaaagcaa |
6305628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University