View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_low_37 (Length: 261)
Name: NF13114_low_37
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 3 - 255
Target Start/End: Complemental strand, 27123658 - 27123406
Alignment:
| Q |
3 |
agggtttattatatagattaaaaaatgttgttcacgtagagattgaattgattaatgattaattaattatatatagtgatacaaaatacacaccttaagt |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27123658 |
agggcttattatatagattaaaaaatgttgtccacgtagagattgaattgattaatgattaattaattatatatagtgatacaaaatacacaccttaagt |
27123559 |
T |
|
| Q |
103 |
ccacgggtgaatcaggccaatggggaagataatcaggcaaaggatggcatatgagtttcaagaaatctctccaacagaacactttgtcttttgtttgact |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27123558 |
ccacgggtgaatcaggccaatggggaagataatcaggcagaggatggcatatgagtttcaagaaatctctccaacagaacactttgtcttttgtttgact |
27123459 |
T |
|
| Q |
203 |
aaagcttgttccatatcgaactgctgctctcatatcagatgtcatgtacttgc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27123458 |
aaagcttgttccatatcgaactgctgctctcatatcagatgtcatgtacttgc |
27123406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 133 - 253
Target Start/End: Original strand, 41605593 - 41605713
Alignment:
| Q |
133 |
aatcaggcaaaggatggcatatgagtttcaagaaatctctccaacagaacactttgtcttttgtttgactaaagcttgttccatatcgaactgctgctct |
232 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||| || || || ||||||| ||| |||||||| |
|
|
| T |
41605593 |
aatcaggcaaaggattacaaatgagtttcaagaaatctctccaacagaacacggagtcttttgtttgactgaaactggtcccatatctaacagctgctct |
41605692 |
T |
|
| Q |
233 |
catatcagatgtcatgtactt |
253 |
Q |
| |
|
|||||||| |||||| ||||| |
|
|
| T |
41605693 |
catatcagttgtcatatactt |
41605713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University