View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13114_low_45 (Length: 214)
Name: NF13114_low_45
Description: NF13114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13114_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 108 - 189
Target Start/End: Original strand, 39017963 - 39018044
Alignment:
| Q |
108 |
gggtacaaatcatattatattattcatgtgatgtattgatgcatctgaattaaattaaagtaaatctttgttgtcttatact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39017963 |
gggtacaaatcatattatattattcatgtgatgtattgatgcatctgaattaaattaaagtaaatctttgttgtcttatact |
39018044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 33 - 87
Target Start/End: Original strand, 13213622 - 13213676
Alignment:
| Q |
33 |
caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213622 |
caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg |
13213676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University