View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13115_high_12 (Length: 259)
Name: NF13115_high_12
Description: NF13115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13115_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 60 - 178
Target Start/End: Original strand, 1989161 - 1989279
Alignment:
| Q |
60 |
tcagcatatgtatagccaccaaaacctacggctactggtaaggtatgttgtaacagatatcaacaccatttcttgataccctttactctctttctagcat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1989161 |
tcagcatatgtatagccaccaaaacctacggctactggtaaggtatgttgtaacagatatcaacaccatttcttgataccctttactctctttctatcat |
1989260 |
T |
 |
| Q |
160 |
ttgtcacttcaaaatttga |
178 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1989261 |
ttgtcacttcaaaatttga |
1989279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University