View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13115_low_10 (Length: 276)
Name: NF13115_low_10
Description: NF13115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13115_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 53 - 266
Target Start/End: Complemental strand, 50307410 - 50307200
Alignment:
| Q |
53 |
tttcaacttgatcatgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307410 |
tttcaacttgatcatgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagt |
50307311 |
T |
|
| Q |
153 |
ttcaacaacattgattgtttctgttgtttcttcattattagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttgga |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307310 |
ttcaacaacattgattgtttctgttgtttcttc---attagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttgga |
50307214 |
T |
|
| Q |
253 |
gtctttgatgatgt |
266 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50307213 |
gtctttgatgatgt |
50307200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 102
Target Start/End: Complemental strand, 50307774 - 50307688
Alignment:
| Q |
16 |
tcaccatgatcgtgcgattgattgatcttaggtacattttcaacttgatcatgttcttgaatattctcaatttcttctacttcccca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50307774 |
tcaccatgatcgtgcgattgattgatcttaggtacattttcaacttgatcatgttcttgaatattctcaattttttctacttcccca |
50307688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 50307678 - 50307605
Alignment:
| Q |
31 |
gattgattgatcttaggtacattttcaacttgatcatgttcttgaatattctcaatttcttctacttccccagc |
104 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
50307678 |
gattgattaatctcaggtacattttcaacttgatcacgttctagaatattctcaattttttctacttccccagc |
50307605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 50307516 - 50307448
Alignment:
| Q |
31 |
gattgattgatcttaggtacattttcaacttgatcatgttcttgaatattctcaatttcttctacttcc |
99 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
50307516 |
gattgattaatctcaggtatattttcaacttgatcacgttcttgaatattctcaattttttctacttcc |
50307448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 50307597 - 50307529
Alignment:
| Q |
31 |
gattgattgatcttaggtacattttcaacttgatcatgttcttgaatattctcaatttcttctacttcc |
99 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
50307597 |
gattgattaatctcaggtacattatcaacttgatcgcgttcttgaatattctcaattttttctacttcc |
50307529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University