View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_high_20 (Length: 206)
Name: NF13116_high_20
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 61 - 189
Target Start/End: Original strand, 19087502 - 19087630
Alignment:
| Q |
61 |
taatcatcaaactaagtaaattcgtaataagttcaaagtcagcaaacagctcggttagtgaactgagaaacatcaaagaaatattatccagtagggttag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19087502 |
taatcatcaaactaagtaaattcgtaataagttcaaagttagcagacagctcggctggtgaactgagaaacatcaaagaaatattatccagtagggttag |
19087601 |
T |
|
| Q |
161 |
ggttcgaatcctggatacaaacataacct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19087602 |
ggttcgaatcctggatacaaacataacct |
19087630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University