View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_low_11 (Length: 290)
Name: NF13116_low_11
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 37 - 274
Target Start/End: Original strand, 38819900 - 38820138
Alignment:
| Q |
37 |
ttaaacattcttctgaaatatatttaatacaaatattttttccaaaggtttaagggcacacgaataaaaaactaactgtcaccaccacgaacctcacacc |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38819900 |
ttaaacattattctgaaatatatttaatacaaatattttttccaaaggtttaagggcacacgaataaaaaactaactgtcaccaccacggacctcacacc |
38819999 |
T |
 |
| Q |
137 |
ctcgtttatatataactcctgaaagtaaattccttatagagtaaattcatcccctacgtnnnnnnnnnnnntgttatagctgaatatccaattgtttgtc |
236 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
38820000 |
ctcgtttaaatataactcccgaaagtaaattccttatagagtaaattcattccctacgtaaaaacaaaaaatgttatagccgaatatccaattgtttgtc |
38820099 |
T |
 |
| Q |
237 |
acatgaatgcgcatacatgttaa-aagaggtagattttt |
274 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38820100 |
acatgaatgcgcatacatgttaacaagaggtagattttt |
38820138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University