View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_low_16 (Length: 241)
Name: NF13116_low_16
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 80 - 236
Target Start/End: Original strand, 33269820 - 33269976
Alignment:
| Q |
80 |
ttgaatttctgtttgaacttggtgtaatgtgagtgagatggtgacagtgtgtgttctattgtttgttactgcttttgctatgggatagatgatgggccat |
179 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33269820 |
ttgaatttctgtttgaacttggtgttatgtgagtgagatggtgacagtgtgtgttctattgtttgttactgcttttgctatgggatagatgatgggacat |
33269919 |
T |
|
| Q |
180 |
gacacactaattgggatgaaaattgctcctccctctcagtttttgctcattcctttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269920 |
gacacactaattgggatgaaaattgctcctccctctcagtttttgctcattcctttg |
33269976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 5 - 83
Target Start/End: Original strand, 33269712 - 33269790
Alignment:
| Q |
5 |
gatgaagatgaaaatgatgaggttttggtttcatggttgatcgtggattatggatatgttgtgtcttacatgttgttga |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269712 |
gatgaagatgaaaatgatgaggttttggtttcatggttgatcgtggattatggatatgttgtgtcttacatgttgttga |
33269790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University