View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_low_19 (Length: 216)
Name: NF13116_low_19
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 12095449 - 12095627
Alignment:
| Q |
19 |
tattactattattttaacacattttcttataaatgccccatgttatatgaggccgataaatgtgtaaccgagtgagtactaattactcacttacaaggag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
12095449 |
tattactattattttaacacattttcttataaatgccccatgttatatgaggccgataaatgtgtaaccgattgagtactaatt--tcacttacaaggag |
12095546 |
T |
|
| Q |
119 |
gcccgttcttgagcaagcgctaagagctctatggagccgggacggccctgcttacaaggaggcaaaggagaaccacacaag |
199 |
Q |
| |
|
|||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12095547 |
gccctttcttgagcaagtgcgaagagctctatggagccgggacggccctgcttacaaggaggcaaaggagaaccacacaag |
12095627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 29 - 116
Target Start/End: Original strand, 12078878 - 12078965
Alignment:
| Q |
29 |
attttaacacattttcttataaatgccccatgttatatgaggccgataaatgtgtaaccgagtgagtactaattactcacttacaagg |
116 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| | ||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12078878 |
attttaacacattttcttacaaatgacccatgtcaaatgaggctgataaatgtgtaaccgagagagtactaattactcacttacaagg |
12078965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University