View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_low_20 (Length: 206)
Name: NF13116_low_20
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 41639100 - 41639279
Alignment:
| Q |
12 |
gaagaatattaaaaggatttcgattttttcttccctagcagcctagagttgtcatgtcatgttttactaattttcttgttcaaaagcataacctttctgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41639100 |
gaagaatattaaaaggatttcgattttttcttccctagcagcctagagttgtcatgtcatgttttactaattttcttgttcaaaagcataacctttcttc |
41639199 |
T |
|
| Q |
112 |
tacaggattactgtatcacaatgtgtttgtgttaaatgaaagttgtaatttgtctcttctcctcgctttagtgttgtttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639200 |
tacaggattactgtatcacaatgtgtttctgttaaatgaaagttgtaatttgtctcttctcctcgctttagtgttgtttt |
41639279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University