View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13116_low_22 (Length: 205)
Name: NF13116_low_22
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13116_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 33269554 - 33269731
Alignment:
| Q |
19 |
gtgagaagtgagagatgggagaatgcgtttgagagttgggttgagagagtaatcagggttgggattgttgttgtggattgtgttgatggattctgagatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269554 |
gtgagaagtgagagatgggagaatgcgtttgagagttgggttgagagagtaatcagggttgggattgttgttgtggattgtgttgatggattctgagatt |
33269653 |
T |
 |
| Q |
119 |
gtgtagaggatgtcatggtttttgtagtgaggttttgaagaaaatgagacaaggttgagatgaagatgaaaatgatga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33269654 |
gtgtagaggatgtcatggtttttgtagtgaggttttgaagaaaatgagacaaggttgtgatgaagatgaaaatgatga |
33269731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University