View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_high_20 (Length: 243)
Name: NF13118_high_20
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 142 - 237
Target Start/End: Complemental strand, 11437265 - 11437174
Alignment:
| Q |
142 |
ttgcagatatgagttaagcatgttagagtgcatatcaaggttttgaaaaatgttggcaaccacaatttacaccgcgacgtcaaaaatgatgatgtc |
237 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11437265 |
ttgcagaaatgagttaagcatgttagagtgcatatcaaggttttgaaaaatgttgg----cacaatttacaccgcgacgtcaaaaatgttgatgtc |
11437174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 11437406 - 11437312
Alignment:
| Q |
1 |
ttctgatagctcaatttatgaagctgttcttcattgcaaaagatccattggtatgtcnnnnnnnnntcaaattccatgtgtgttaatagatagag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11437406 |
ttctgatagctcaatttatgaagctgttcttcattgcaaaagatccattggtatgtcaaaaaaaattcaaattccatgtgtgttaatagatagag |
11437312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 11430089 - 11430033
Alignment:
| Q |
1 |
ttctgatagctcaatttatgaagctgttcttcattgcaaaagatccattggtatgtc |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
11430089 |
ttctgatagctcaatttatgaagccgttcttcattgcaaaagatcaattggtatgtc |
11430033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 11422898 - 11422852
Alignment:
| Q |
11 |
tcaatttatgaagctgttcttcattgcaaaagatccattggtatgtc |
57 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11422898 |
tcaatttataatgctgttcttcattgcaaaagatccattggtatgtc |
11422852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 11429949 - 11429889
Alignment:
| Q |
150 |
atgagttaagcatgttagagtgcatatcaaggttttgaaaaatgttggcaaccacaattta |
210 |
Q |
| |
|
|||| ||||||||| || |||||| ||||||||||||||||| ||| |||| ||| ||||| |
|
|
| T |
11429949 |
atgaattaagcatgctaaagtgcacatcaaggttttgaaaaaggtttgcaaacaccattta |
11429889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 44907720 - 44907774
Alignment:
| Q |
1 |
ttctgatagctcaatttatgaagctgttcttcattgcaaaagatccattggtatg |
55 |
Q |
| |
|
|||||| |||||||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
44907720 |
ttctgaaagctcaatacatgaggcagttctccattgcaaaagatccattggtatg |
44907774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University