View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_low_11 (Length: 294)
Name: NF13118_low_11
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 6463598 - 6463386
Alignment:
| Q |
16 |
cacacacttggagta--tttgctttagacctttacaaattgctatatttgcttttatcttgagtaattaagtaatcttgatagttaagttatgtctattt |
113 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
6463598 |
cacacacttggagtacatttgctttggacctttacaaattgctatatttgcttttatcttgagtaattaagtaatctcgatagctaagttatgtctattt |
6463499 |
T |
|
| Q |
114 |
ttctaccaccattttgatattttcttgtggtgagttaagttccattattaaaatctcttccactatattatcataatttttaaactttaatcaatcattg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6463498 |
ttctaccaccattttgatattttcttgtggtgagttaagtttcattattaaaacctcttccactatattatcataatttttaaactttaatcaatcattg |
6463399 |
T |
|
| Q |
214 |
gctgattgtactc |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6463398 |
gctgattgtactc |
6463386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University