View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_low_16 (Length: 259)
Name: NF13118_low_16
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_low_16 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 94 - 259
Target Start/End: Original strand, 3641452 - 3641617
Alignment:
| Q |
94 |
atttcacttatttatcttcatgattccaccagtacattctaggaccttgatcgcggcattgtctaaggttgctnnnnnnntctttacaatgtcagcgtac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3641452 |
atttcacttatttatcttcatgattccaccagtacattctgggtccttgatcgcggcattgtctaaggttgctaaaaaaatctttacaatgtcagcgtac |
3641551 |
T |
|
| Q |
194 |
atgctttacaaatatatctaattacaaatataaatatctatacaataagatatgtgggtaaaaaat |
259 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641552 |
atgcttgacaaatatatctaattacaaatataaatatctatacaataagatatgtgggtaaaaaat |
3641617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 3641314 - 3641400
Alignment:
| Q |
8 |
gaagcataggaaaaatgcatagttcaaaaagttgtgcaacttcatccacacaaaagctgccaatacattacagaaaattacagaaaa |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3641314 |
gaagcaaaggaaaaatgcatagttcaaaaagttgtgcaacttcatccacacaacagctgccaatacattacagaaaattacagaaaa |
3641400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University