View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_low_22 (Length: 238)
Name: NF13118_low_22
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 19337925 - 19338147
Alignment:
| Q |
1 |
taaagttgatgcatgtgtctttgaggttttctagctgtcgtttcagtgcttggaaatttgccttctgcaagtcggttacaaaattcagagttttctatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19337925 |
taaagttgatgcatgtgtctttgaggttttctagctgtcgtttcagtgcttggaaatttgccttctgcaagttggttacaaaattcagagttttctatat |
19338024 |
T |
|
| Q |
101 |
ctcagcattcagctctaccacgacgagttttggtaatctttcctgttatcaaataattataactttgttatttcgtttaactgggaagttgataaatgtt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19338025 |
ctcagcattcagctctacaacgacgagttttggtaatctttcctgttatcaaataattataactttgttatttcgtttaactgggaagttgataaatgtt |
19338124 |
T |
|
| Q |
201 |
atatcagaggtgaccgttatatg |
223 |
Q |
| |
|
||||||||||| ||| ||||||| |
|
|
| T |
19338125 |
atatcagaggtaaccattatatg |
19338147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 121
Target Start/End: Original strand, 18171148 - 18171228
Alignment:
| Q |
41 |
tttcagtgcttggaaatttgccttctgcaagtcggttacaaaattcagagttttctatatctcagcattcagctctaccac |
121 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||| | | |||||| |||||||||| || |||||| |||||| |
|
|
| T |
18171148 |
tttcagtgtatggaaatttgccttctgcaagtcagttacaagaatgggagtttgctatatctcaacactcagctttaccac |
18171228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University