View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_low_23 (Length: 235)
Name: NF13118_low_23
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 117 - 211
Target Start/End: Complemental strand, 24666128 - 24666034
Alignment:
| Q |
117 |
tcatatagcaaatgatgtgcttacaaatgatcaacaggacgggtgaaaaatccagattttgttaaccaagtagaagcaatatataagagtgagga |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24666128 |
tcatataacaaatgatgtgcttacaaatgatcaacaggacgggtgaaaaatccagattttgttaaccaagtagaagcaatatataagagtgagga |
24666034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 24666493 - 24666401
Alignment:
| Q |
20 |
acttgtcttcagattcaatattct-ctccttatgggtagaggtagctacaaagtatcaataataataaatttaacaaattttagtttgtaaat |
111 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| || ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
24666493 |
acttgtcttcagattcaattttctgctccttataggcagaggtagctacaaagtatcagtaataatatatttaacaaattttagtttgtaaat |
24666401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 211
Target Start/End: Original strand, 5409986 - 5410057
Alignment:
| Q |
140 |
caaatgatcaacaggacgggtgaaaaatccagattttgttaaccaagtagaagcaatatataagagtgagga |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
5409986 |
caaatgatcaacaggaagggtgaaaaatcctgattttgttaaccaagttgcagcaatatgtaagagtgagga |
5410057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 149 - 211
Target Start/End: Original strand, 37218955 - 37219017
Alignment:
| Q |
149 |
aacaggacgggtgaaaaatccagattttgttaaccaagtagaagcaatatataagagtgagga |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
37218955 |
aacaggacgggtgaaaaatcttgattttgttaaccaagttgcagcaatatgtaagagtgagga |
37219017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University