View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13118_low_7 (Length: 379)
Name: NF13118_low_7
Description: NF13118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13118_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 26 - 197
Target Start/End: Complemental strand, 10334023 - 10333852
Alignment:
| Q |
26 |
aagaagtagagaaaaagatccatgttattcaaaccagattaaagcaacaggccacactgatatttagatgaataaagaaaaagtaactcaaatagagcta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10334023 |
aagaagtagagaaaaagatccatgttattcaaacgagattaaagcaacaggccacactgatatttagatgaatcaagaaaaagtagctcaaatagagcta |
10333924 |
T |
|
| Q |
126 |
gatgccgctcttgaaagagaatagagcacaacaaaattgataacctccctaaaaagtgttgatgaagttctc |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10333923 |
gatgcagctcttgaaagagaatagagcacaacaaaattgataacctccctaaaaagtgctgatgaacttctc |
10333852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 243 - 361
Target Start/End: Original strand, 10334201 - 10334317
Alignment:
| Q |
243 |
catgtttagttgcagaatgcaatcccctatgcccctaatccccaaaaatggtgttgaattcacaaaagaaacaccggggaatgtctaattggttctacaa |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10334201 |
catgtttagttgcagaatgcaatcccctatgcccctaatccccaaaaatggtgttgaattcacaaaagaaacaccagggaatgtctaattggttctacaa |
10334300 |
T |
|
| Q |
343 |
actatcgcaagcttgttcc |
361 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
10334301 |
actat--caagcttgttcc |
10334317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University