View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_25 (Length: 410)
Name: NF13119_high_25
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 10361617 - 10361441
Alignment:
| Q |
19 |
gcaaaatcatacgctgctgtcatgattgttactagattagggagttgaaatactggtatgagctctcttgtctggttttacttgattttggtttacttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10361617 |
gcaaaatcatacgctgctgtcatgattgttactggattaggcagttgaaatactggcatgagctctcttgtctggttttgattgattttggtttacttgt |
10361518 |
T |
|
| Q |
119 |
gactgagaagcaagttttattatgtattatcgaataaaccagctaggttcccctttatggagttaaaaggtaatgag |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10361517 |
gactgggaagcaagttttattatgtattaacgaataaaccagctaggttccccttttaggagttaaaaggtaatgag |
10361441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 251 - 385
Target Start/End: Complemental strand, 10361382 - 10361249
Alignment:
| Q |
251 |
ctggctatcctattcgtttgatgataattgacaagtctgtgaaaacacaattctgacattacgtattgcatacatttggtttttgagtaaaatttggcaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10361382 |
ctggctatcctattcgtttgatgataattgacaagtatgtgaaaacacaattctgacattacgtattgcatacatttggtttttgagtaaaatttggcaa |
10361283 |
T |
|
| Q |
351 |
tccaataatgaatagtttgaacgctcgtttgctct |
385 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10361282 |
tccaataatgaatag-ttgaacgctcgtttgctct |
10361249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University