View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13119_high_33 (Length: 347)

Name: NF13119_high_33
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13119_high_33
NF13119_high_33
[»] chr1 (3 HSPs)
chr1 (201-302)||(38209904-38210007)
chr1 (6-94)||(38210064-38210152)
chr1 (120-167)||(38210019-38210066)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 201 - 302
Target Start/End: Complemental strand, 38210007 - 38209904
Alignment:
201 tagtatacaaatgacttgacacaattttattcccaaattggttta--caaacgtgcatgctgactaccgagaatcaaatcccaagttactagtaccttct 298  Q
    ||||||||||||||||||||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
38210007 tagtatacaaatgacttgacacaattttattcccaaattggttgaaacaaacgtgcatgctgactaccgagaatcaaatcccaagttactagtaccttct 38209908  T
299 ttgt 302  Q
    ||||    
38209907 ttgt 38209904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 6 - 94
Target Start/End: Complemental strand, 38210152 - 38210064
Alignment:
6 agcagcacagaaacaatggagtttttagataagtgcaattctaaacaatttcacaacgtttagaattgttgttatgaacaattgtagat 94  Q
    |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||    
38210152 agcatcacaaaaacaatggagtttttagataagtgcaattctaaacaatttcacaacgtttagaattgttgtttagaacaattgtagat 38210064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 38210066 - 38210019
Alignment:
120 gatgtaccgtgtgcggttgttacatgggatcttgatcggagttttagt 167  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||    
38210066 gatgtaccgtgtgcggttgttacatgggatcctgatcggagttttagt 38210019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University