View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_42 (Length: 269)
Name: NF13119_high_42
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 3 - 250
Target Start/End: Complemental strand, 45459291 - 45459044
Alignment:
| Q |
3 |
gatgtccaagaatatgaaatatctcctggtcaaatttcttgatgaaacagttgttgacatgtagatgagggtgtttgaaatcgacaaaaatcattacttc |
102 |
Q |
| |
|
|||| |||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459291 |
gatgaccaacaacatgaaatatctcctggtcaaatttcttgatgaaacagttgttgacaagtagatgagggtgtttgaaatcgacaaaaatcattacttc |
45459192 |
T |
 |
| Q |
103 |
gtcacatcatcacacataaaatttgttccagaaactcaaacaaaccaagagacaaccacgactaatcctccccacatatgccttgtgctacagaaggatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459191 |
gtcacatcatcacacataaaatttgttcccgaaactcaaacaaaccaagagacaaccacgactaatcctccccacatatgccttgtgctacagaaggatc |
45459092 |
T |
 |
| Q |
203 |
tagacttaattaaacattttttggttaatgagaacgagaacttagagg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45459091 |
tagacttaattaaacattttttggttaatgagaacgaggacttagagg |
45459044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 250
Target Start/End: Complemental strand, 23536569 - 23536512
Alignment:
| Q |
193 |
cagaaggatctagacttaattaaacattttttggttaatgagaacgagaacttagagg |
250 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||| |||||||||| ||| | ||||||| |
|
|
| T |
23536569 |
cagaaggatcttgacttaattaaacatatattgattaatgagaaagaggatttagagg |
23536512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University