View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_47 (Length: 262)
Name: NF13119_high_47
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_47 |
 |  |
|
| [»] scaffold0425 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0425 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 130 - 241
Target Start/End: Complemental strand, 3937 - 3826
Alignment:
| Q |
130 |
ggtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgactttcccatggtgggaagattttcaagtgtcccatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3937 |
ggtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgactttcccatggtgggaagattttcaagtgtcccatg |
3838 |
T |
 |
| Q |
230 |
taaaatgccacc |
241 |
Q |
| |
|
| |||||||||| |
|
|
| T |
3837 |
tgaaatgccacc |
3826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0425; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 4527 - 4572
Alignment:
| Q |
185 |
aaaatgtgactttcccatggtgggaagattttcaagtgtcccatgt |
230 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| |||||||||| |||| |
|
|
| T |
4527 |
aaaaagtgactttctcatggtgggaagattatcaagtgtcctatgt |
4572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 131 - 240
Target Start/End: Complemental strand, 325438 - 325329
Alignment:
| Q |
131 |
gtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgactttcccatggtgggaagattttcaagtgtcccatgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
325438 |
gtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgacttttctatggtgggaagattttcaagtgtcccatgt |
325339 |
T |
 |
| Q |
231 |
aaaatgccac |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
325338 |
taaatgccac |
325329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 207
Target Start/End: Complemental strand, 34852676 - 34852591
Alignment:
| Q |
122 |
gtttagcaggtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgactttcccatggtgg |
207 |
Q |
| |
|
||||| || ||||||||||||| || |||||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34852676 |
gtttaacaagtatcccttcctttattttaaccactcaatattatatgaatatatcaatggctaaaaatgtaactttcccatggtgg |
34852591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 325641 - 325697
Alignment:
| Q |
185 |
aaaatgtgactttcccatggtgggaagattttcaagtgtcccatgtaaaatgccacc |
241 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
325641 |
aaaaagtgattttcccatggtgggaaggttttcaaatgtcccatgttaaatgccacc |
325697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 93
Target Start/End: Complemental strand, 325510 - 325475
Alignment:
| Q |
58 |
agtaattggttttcaaagctttaactgttattgcta |
93 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
325510 |
agtaattggttttcaaagctttaattgttattgcta |
325475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 199
Target Start/End: Original strand, 31912245 - 31912322
Alignment:
| Q |
122 |
gtttagcaggtatcccttccttcatcttaaccactcaatattatataaatatatcaatggttaaaaatgtgactttcc |
199 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
31912245 |
gtttaacaagtatcccttccatcatcttaaccactcaatattatatgaatatatcaatggctaaaaatgtaactttcc |
31912322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 50657005 - 50656957
Alignment:
| Q |
193 |
actttcccatggtgggaagattttcaagtgtcccatgtaaaatgccacc |
241 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
50657005 |
acttttccatggtgggaagattttcaagtgtctcatgtgaaataccacc |
50656957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 42423227 - 42423275
Alignment:
| Q |
193 |
actttcccatggtgggaagattttcaagtgtcccatgtaaaatgccacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
42423227 |
actttcccatggtgggaagattttcaagtgtctcatgtgaaatgccacc |
42423275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 35214632 - 35214584
Alignment:
| Q |
193 |
actttcccatggtgggaagattttcaagtgtcccatgtaaaatgccacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
35214632 |
actttcccatggtgggaagattttcaagtgtctcatgttaaatgtcacc |
35214584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 3148241 - 3148193
Alignment:
| Q |
193 |
actttcccatggtgggaagattttcaagtgtcccatgtaaaatgccacc |
241 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
3148241 |
acttttccatgatgggaagattttcaagtgtcccgtgttaaatgccacc |
3148193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University