View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_48 (Length: 257)
Name: NF13119_high_48
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 29122051 - 29122296
Alignment:
| Q |
1 |
gcttcaaccctgatgcagaagccatgaattaaattgaagatattgtatatatttattgtttctacaaggagatatgtctcaatttatatccatggctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29122051 |
gcttcaaccctgatgcagaagccatgaattaaattgaagatattgtatatatttgttgtttctacaaggagatatgtctcaatttatatgcatggctatt |
29122150 |
T |
|
| Q |
101 |
tatactttgtacattatgtatgaattgggacccatgcaaaggtgcaagagtgggagaaagaacatttgcaatggccaatgagtatgagaatttctaagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29122151 |
tatactttgtacattatgtatgaattgggacccatgcaaaggtgcaagagtgggagaaagaacatttgcaatggccaatgagtatgaaaatttctaagag |
29122250 |
T |
|
| Q |
201 |
ggaactattggtatcattcttttcttctttgtttcattgtgatgat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29122251 |
ggaactattggtatcattcttttcttctttgtttcattgtggtgat |
29122296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University