View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_54 (Length: 250)
Name: NF13119_high_54
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 2249898 - 2250125
Alignment:
| Q |
15 |
actatcactgatgtcttgaatgtgagatcccctggtggcagggaatccaaattcaatcctaactaagttttaactatctttaataatctcctactaattc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2249898 |
actatcactgatgtcttgaatgtgagatccccgggtggcagggaatccaaattcaatcctaacttagttttaactatctttaataatctcctactaattc |
2249997 |
T |
 |
| Q |
115 |
taacatctttttatattcttcatagttttcttattgaaggga--atatgaaatgttgttttggttttgatgtgcagggaaatccaattgattgggtgagt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2249998 |
taacatctttttttattcttcatagttttcttattgaagggaatatatgaaatgttgttttgattttgatgtgcagggaaatccaattgattgggtgagt |
2250097 |
T |
 |
| Q |
213 |
actcataggtatcaccaccagttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2250098 |
actcataggtatcaccaccagttctgtg |
2250125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University