View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_67 (Length: 215)
Name: NF13119_high_67
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 198
Target Start/End: Complemental strand, 12616289 - 12616101
Alignment:
| Q |
10 |
gaagaatatggtttcttcaatgtgattaaccatggtgtcccttatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616289 |
gaagaatatggtttcttcaatgtgattaaccatggtgtccctcatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatgg |
12616190 |
T |
|
| Q |
110 |
aacaaaagaaactagttgcacctggtaatccctatggttatggatgcaagaatattgggttcaatggagacatgggtgaggtggaatat |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616189 |
aacaaaagaaactagttgcacttggtaatccctttggttatggatgcaagaatattgggttcaatggagacatgggtgaggtggaatat |
12616101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University