View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_high_68 (Length: 208)
Name: NF13119_high_68
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 36949994 - 36949823
Alignment:
| Q |
17 |
atatatgttacatggaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgccccc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36949994 |
atatatgttacatggaatgcctagtagatcacatatgcacc---ttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgccccc |
36949898 |
T |
|
| Q |
117 |
ttggtttgttgcatatattttgcttgaaaaggattcttaagtgtgttatatatataggtcaacaatgttagtaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36949897 |
ttggtttgttgcatatattttgcttgaaaaggattcttaagtgtgttatatatataggtcaacaatgttagtaat |
36949823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 31 - 137
Target Start/End: Original strand, 10818104 - 10818210
Alignment:
| Q |
31 |
gaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccccttggtttgttgcat |
130 |
Q |
| |
|
||||||||||||||||| ||||||| | | |||||||| |||||||||||||||||| |||||||||| ||||| ||||||||| | ||||||||| |
|
|
| T |
10818104 |
gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatctttgcccccttcgattgttgcat |
10818203 |
T |
|
| Q |
131 |
atatttt |
137 |
Q |
| |
|
||||||| |
|
|
| T |
10818204 |
atatttt |
10818210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University