View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_35 (Length: 347)
Name: NF13119_low_35
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 201 - 302
Target Start/End: Complemental strand, 38210007 - 38209904
Alignment:
| Q |
201 |
tagtatacaaatgacttgacacaattttattcccaaattggttta--caaacgtgcatgctgactaccgagaatcaaatcccaagttactagtaccttct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38210007 |
tagtatacaaatgacttgacacaattttattcccaaattggttgaaacaaacgtgcatgctgactaccgagaatcaaatcccaagttactagtaccttct |
38209908 |
T |
|
| Q |
299 |
ttgt |
302 |
Q |
| |
|
|||| |
|
|
| T |
38209907 |
ttgt |
38209904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 6 - 94
Target Start/End: Complemental strand, 38210152 - 38210064
Alignment:
| Q |
6 |
agcagcacagaaacaatggagtttttagataagtgcaattctaaacaatttcacaacgtttagaattgttgttatgaacaattgtagat |
94 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38210152 |
agcatcacaaaaacaatggagtttttagataagtgcaattctaaacaatttcacaacgtttagaattgttgtttagaacaattgtagat |
38210064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 38210066 - 38210019
Alignment:
| Q |
120 |
gatgtaccgtgtgcggttgttacatgggatcttgatcggagttttagt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38210066 |
gatgtaccgtgtgcggttgttacatgggatcctgatcggagttttagt |
38210019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University